Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS132M05

Clone ID RBdS132M05
HP ID HP09196
Gene ID 90826
Gene Symbol PRMT10
Protein Name protein arginine methyltransferase 10 (putative)
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_138364.2
Length of RefSeq (bp) 2842
Chromosome 4q31.23
Reference DDBJ accession
UniGene Hs.591692
5'-terminal sequence AGCAAGAGAAGTGATAAGAGAGGCACAGTCAACATATAGGAGGCAAACATGGATGATGCA
2011.08.28