Prev. | 

RIKEN DNA Bank Human Resource - WDR34

Gene ID NCBI Gene 89891 |  KEGG hsa:89891
Gene Symbol WDR34
Protein Name WD repeat domain 34
Synonyms DIC5|FAP133|SRTD11|bA216B9.3
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083413 IRAL008I21 pOTB7 BC001614 NM_052844 Partial/var
HGY091216 IRAL028A16 pOTB7 BC011874 NM_052844 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR386078 RBd65D06 pGCAP10 NM_052844.3  
GAGCCGGGGCCACTCAGCCAGGCGGGAAGCGCTGGTGTTGCGGCGCTGGCGACAGTCGGG
HKR393751 RBd84G07 pGCAP10 NM_052844.3  
GGGGGTTGCGAGCGGCCCGGGGCCGGGGCGGCCAGGGCCGCTGCAGGACGAGACCCTGGG
HKR461968 RBdS154P08 pGCAP10 NM_052844.3  
GAGTCGGGGTTGCGAGCGGCCCGGGGCCGGGGCGGCCAGGGCCGCTGCAGGACGAGACCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl