Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS154P08

Clone ID RBdS154P08
HP ID HP08276
Gene ID 89891
Gene Symbol WDR34
Protein Name WD repeat domain 34
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_052844.3
Length of RefSeq (bp) 1818
Chromosome 9q34.11
Reference DDBJ accession
UniGene Hs.495240
5'-terminal sequence GAGTCGGGGTTGCGAGCGGCCCGGGGCCGGGGCGGCCAGGGCCGCTGCAGGACGAGACCC
2011.08.28