Prev. | 

RIKEN DNA Bank Human Resource - GON7

Gene ID NCBI Gene 84520 |  KEGG hsa:84520
Gene Symbol GON7
Protein Name GON7 subunit of KEOPS complex
Synonyms C14orf142|PNAS-127
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY018420 IRAK046A20 pBluescriptR BC021733 NM_032490 Full
HGX055601 IRAK139A01 pCMV-SPORT6 BC065216 NM_032490 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR408947 RBdS022G03 pGCAP10 NM_032490.4  
CGGCCGGCCGATGGCTTCCCGGTGTCGTGTTCTGGAAGCTTAGCGGTCACCATGGAGCTG
HKR433206 RBdS083A06 pGCAP10 NM_032490.4  
GACTCCTCTCCCTTCTCCCGCCTGCGCCGGACGCGGGCTGATTTCCGCCTCCGGGTGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl