Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS022G03

Clone ID RBdS022G03
HP ID HP08926
Gene ID 84520
Gene Symbol C14orf142
Protein Name chromosome 14 open reading frame 142
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_032490.4
Length of RefSeq (bp) 1191
Chromosome 14q32.12
Reference DDBJ accession
UniGene Hs.20142
5'-terminal sequence CGGCCGGCCGATGGCTTCCCGGTGTCGTGTTCTGGAAGCTTAGCGGTCACCATGGAGCTG
2011.08.28