Prev. | 

RIKEN DNA Bank Human Resource - METTL26

Gene ID NCBI Gene 84326 |  KEGG hsa:84326
Gene Symbol METTL26
Protein Name methyltransferase like 26
Synonyms C16orf13|JFP2
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY087566 IRAL018P06 pOTB7 BC007207 NM_001040161 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR045775 ARe14H07 pKA1U5 NM_032366.3  
GGTTGTTGCTGCCGCGATGCTGGTGGCGGCGGCCNTNGAGCGGAACAAGGATCCCATCTT
HKR235278 ARiS088D06 pGCAP10 NM_032366.3  
GGCGACCCGCGCCGCGTCCGCGGCGGGGAGTTGTTGCTGCCGCGATGCTGGTGGCGGCGG
HKR346857 RBb67C09 pGCAP1 NM_032366.3  
TGGTTGTTGCTGCCGCGATGCTGGTGGCGGCGGCCGCGGAGCGGAACAAGGATCCCATCT
HKR348805 RBb72A05 pGCAP1 NM_032366.3  
GGCCCCCGACGCGACCCGCGCCGCGTCCGCGGCGGGGAGTTGTTGCTGCCGCGATGCTGG
HKR375228 RBd38B04 pGCAP10 NM_032366.3  
GGCGGCGGCCGCGGAGCGGAACAAGGATCCCATCTTGCACGTGCTGCGGCAGTACCTGGA
HKR378546 RBd46G02 pGCAP10 NM_032366.3  
GGGCCGCGGAGCGGAACAAGGATCCCATCTTGCACGTGCTGCGGCAGTACCTGGATCCGG
HKR388155 RBd70G11 pGCAP10 NM_032366.3  
GGTCCGCGGCGGGGAGTTGTTGCTGCCGCGATGCTGGTGGCGGCGGCCGCGGAGCGGAAC
HKR452805 RBdS132A05 pGCAP10 NM_032366.3  
GGTTGTTGCTGCCGCGATGCTGGTGGCGGCGGCCGCGGAGCGGAACAAGGATCCCATCTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl