Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS132A05

Clone ID RBdS132A05
HP ID HP04852
Gene ID 84326
Gene Symbol C16orf13
Protein Name chromosome 16 open reading frame 13
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_032366.3
Length of RefSeq (bp) 854
Chromosome 16p13.3
Reference DDBJ accession
UniGene Hs.239500
5'-terminal sequence GGTTGTTGCTGCCGCGATGCTGGTGGCGGCGGCCGCGGAGCGGAACAAGGATCCCATCTT
2011.08.28