Prev. |  KEGG KO K06127 > 

RIKEN DNA Bank Human Resource - COQ5

Gene ID NCBI Gene 84274 |  KEGG hsa:84274
Gene Symbol COQ5
Protein Name coenzyme Q5, methyltransferase
Synonyms -
Ortholog resources KEGG ortholog (KEGG orthology K06127) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY084418 IRAL011A18 pOTB7 BC004916 NM_032314 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR048952 ARe22G08 pKA1U5 NM_032314.3  
GGACTACCAAGATGGCGGCCCCCGGGAGCTGTGCTCTATGGAGCTATTGCGGCCGTGGGT
HKR461769 RBdS154H01 pGCAP10 NM_032314.3  
GCCCTTCTGCACAAGACAACAAGAGTTCCTGGATATCTTGCGAAACTCCTTTAATGTGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl