Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS154H01

Clone ID RBdS154H01
HP ID HP03233
Gene ID 84274
Gene Symbol COQ5
Protein Name coenzyme Q5 homolog, methyltransferase (S. cerevisiae)
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_032314.3
Length of RefSeq (bp) 1530
Chromosome 12q24.31
Reference DDBJ accession
UniGene Hs.700658
5'-terminal sequence GCCCTTCTGCACAAGACAACAAGAGTTCCTGGATATCTTGCGAAACTCCTTTAATGTGAA
2011.08.28