Prev. |  KEGG KO K11308 > 

RIKEN DNA Bank Human Resource - KAT8

Gene ID NCBI Gene 84148 |  KEGG hsa:84148
Gene Symbol KAT8
Protein Name lysine acetyltransferase 8
Synonyms MOF|MYST1|ZC2HC8|hMOF
Ortholog resources KEGG ortholog (KEGG orthology K11308) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY030276 IRAK075L12 pBluescriptR BC037773 NM_032188 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE042097 W01A105E01 pENTR-TOPO flj0029m04 AK024102 NM_032188  
HGE042099 W01A105E03 pENTR-TOPO flj0029m04 AK024102 NM_032188  
HGE042101 W01A105E05 pENTR-TOPO flj0029m04 AK024102 NM_032188  
HGE042103 W01A105E07 pENTR-TOPO flj0029m04 AK024102 NM_032188  
HGE042105 W01A105E09 pENTR-TOPO flj0029m04 AK024102 NM_032188  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR362030 RBd05B06 pGCAP10 NM_032188.1  
GACTTCCCTTCCCGCGATGGCGGCACAGGGAGCTGCTGCGGCGGTTGCGGCGGGGACTTC
HKR416204 RBdS040I12 pGCAP10 NM_032188.1  
GCTTCCCGCGATGGCGGCACAGGGAGCTGCTGCGGCGGTTGCGGCGGGGACTTCAGGGGT
HKR442215 RBdS105I23 pGCAP10 NM_032188.1  
GGTCACTTCCCTTCCCGCGATGGCGGCACAGGGAGCTGCTGCGGCGGTTGCGGCGGGGAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl