Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS105I23

Clone ID RBdS105I23
HP ID HP03981
Gene ID 84148
Gene Symbol MYST1
Protein Name MYST histone acetyltransferase 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_032188.1
Length of RefSeq (bp) 1518
Chromosome 16p11.2
Reference DDBJ accession
UniGene Hs.533803
5'-terminal sequence GGTCACTTCCCTTCCCGCGATGGCGGCACAGGGAGCTGCTGCGGCGGTTGCGGCGGGGAC
2011.08.28