Prev. |  KEGG KO K06271 > 

RIKEN DNA Bank Human Resource - TLN2

Gene ID NCBI Gene 83660 |  KEGG hsa:83660
Gene Symbol TLN2
Protein Name talin 2
Synonyms ILWEQ
Ortholog resource in our bank

  TLN2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB03857 SEREX clone NGO-St-131 (ID 1346) #1 SEREX clone NGO-St-131 (ID 1346) #1

webcatalog20220516.tab


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR347633 RBb69B09 pGCAP1 NM_015059.3 partial  
AAATGTGGGTTCCGCGCCCGGAGCCAGCGGCGGCGGCAGCGGCTGAGGCGGCTGCGGGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.10.11

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl