RBb69B09 - NRCD Human cDNA Clone

Catalog Number HKR347633 Clone Name RBb69B09 Clone info. Plasmid clone of human TLN2 cDNA with SV40 promoter Vector(1) pGCAP1 5'-terminal sequence(2) AAATGTGGGTTCCGCGCCCGGAGCCAGCGGCGGCGGCAGCGGCTGAGGCGGCTGCGGGAG Sequence, submitted(3) AB621808 [link] Note Partial cds when compared using AB621808   Sequence, refered NM_015059.3 (NCBI RefSeq mRNA) Gene Symbol and ID(4) TLN2 (NCBI Gene 83660)  other clone of TLN2 in our bank Synonyms ILWEQ Protein Name talin 2

Links   KEGG   NCBI Gene   NCBI RefSeq

(1) Please refer below or Vector Backbone at NRCD Human cDNA Clone HP.
pKA1U5 (accession no. AB191256 (map of pKA1U5)
pGCAP1 (accession no. AB191257 (map of pGCAP1)
pGCAP10 (accession no. AB371573 (map of pGCAP10)
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

How to cite this biological resource

Materials & Methods section:

Sequence information

Restriction map is not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference

2023.07.07