Prev. | 

RIKEN DNA Bank Human Resource - GSG1

Gene ID NCBI Gene 83445 |  KEGG hsa:83445
Gene Symbol GSG1
Protein Name germ cell associated 1
Synonyms -
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX027378 IRAK068H10 pCMV-SPORT6 BC033854 NM_031289 Full/var
HGY082717 IRAL006N05 pOTB7 BC001796 NM_031289 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR381330 RBd53F10 pGCAP10 NM_031289.2  
GATTAAACCAAAGGGACTTGGAGTGCAGATGGCATCCTTCGGTTCTTCCAGACAAGCTGC
HKR385259 RBd63C11 pGCAP10 NM_031289.2  
TAAAGGGACTTGGAGTGCAGATGGCATCCTTCGGTTCTTCCAGACAAGCTGCAAGACGCT
HKR390525 RBd76F05 pGCAP10 NM_031289.2  
GCTTGCAACATTAAACCAAAGGGACTTGGAGTGCAGATGGCATCCTTCGGTTCTTCCAGA
HKR398947 RBd97G03 pGCAP10 NM_031289.2  
GATTAAACCAAAGGGACTTGGAGTGCAGATGGCATCCTTCGGTTCTTCCAGACAAGCTGC
HKR428373 RBdS070P13 pGCAP10 NM_031289.2  
GAAACCAAAGGGACTTGGAGTGCAGATGGCATCCTTCGGTTCTTCCAGACAAGCTGCAAG
HKR441824 RBdS104J08 pGCAP10 NM_031289.2  
GATCCTTCGGTTCTTCCAGACAAGCTGCAAGACGCTGACCATGGCCAAGATGGAGCTCTC
HKR444233 RBdS110J17 pGCAP10 NM_031289.2  
GATCCTTCGGTTCTTCCAGACAAGCTGCAAGACGCTGACCATGGCCAAGATGGAGCTCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl