Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS110J17

Clone ID RBdS110J17
HP ID HP03371
Gene ID 83445
Gene Symbol GSG1
Protein Name germ cell associated 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_031289.2
Length of RefSeq (bp) 2066
Chromosome 12p13.1
Reference DDBJ accession
UniGene Hs.240053
5'-terminal sequence GATCCTTCGGTTCTTCCAGACAAGCTGCAAGACGCTGACCATGGCCAAGATGGAGCTCTC
2011.08.28