Prev. |  KEGG KO K00773 > 

RIKEN DNA Bank Human Resource - QTRT1

Gene ID NCBI Gene 81890 |  KEGG hsa:81890
Gene Symbol QTRT1
Protein Name queuine tRNA-ribosyltransferase catalytic subunit 1
Synonyms FP3235|TGT|TGUT
Ortholog resource in our bank

  QTRT1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008025 IRAK020B01 pCMV-SPORT6 BC015350 NM_031209 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR205439 ARiS013J23 pGCAP10 NM_031209.1  
GCCACGTGGTTCCGACAGTCAAGATGGCGGGAGCAGCTACCCAGGCTTCCCTGGAGTCGG
HKR374969 RBd37H01 pGCAP10 NM_031209.1  
GAGTCAAGATGGCGGGAGCAGCTACCCAGGCTTCCCTGGAGTCGGCCCCACGGATCATGC
HKR432549 RBdS081G05 pGCAP10 NM_031209.1  
GGAACANCTGGACGCTCTGGGTTGCCGCATCTGCCTGGGCAATACCTACCATCTGGGTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl