Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS081G05

Clone ID RBdS081G05
HP ID HP01178
Gene ID 81890
Gene Symbol QTRT1
Protein Name queuine tRNA-ribosyltransferase 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_031209.1
Length of RefSeq (bp) 1313
Chromosome 19p13.3
Reference DDBJ accession
UniGene Hs.631638
5'-terminal sequence GGAACANCTGGACGCTCTGGGTTGCCGCATCTGCCTGGGCAATACCTACCATCTGGGTCT
2011.08.28