Prev. | 

RIKEN DNA Bank Human Resource - CYB5B

Gene ID NCBI Gene 80777 |  KEGG hsa:80777
Gene Symbol CYB5B
Protein Name cytochrome b5 type B
Synonyms CYB5-M|CYPB5M|OMB5
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083348 IRAL008G04 pOTB7 BC014431 NM_030579 Full
HGY085572 IRAL013P12 pOTB7 BC004373 NM_030579 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR062571 ARe56H03 pKA1U5 NM_030579.2  
GACGGAAGCCGAGGAAGGCTGAGCGCGGGCTCNCNAGGAAAGTAGTCGCGGAATCTCAGT
HKR203402 ARiS008I10 pGCAP10 NM_030579.2  
GAGTTAGCGGTGGAGAGGCAGTATGTCCGGTTCAATGGCGACTGCGGAAGCTAGCGGCAG
HKR393284 RBd83D12 pGCAP10 NM_030579.2  
GAGGAAGGCTGAGCGCGGGCTCTCAAGGAAAGTAGTCGCGGAATCTCAGTTAGCGGTGGA
HKR442216 RBdS105I24 pGCAP10 NM_030579.2  
TTGAAGGCTGAGCGCGGGCTCTCAAGGAAAGTAGTCGCGGAATCTCAGTTAGCGGTGGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl