Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS105I24

Clone ID RBdS105I24
HP ID HP03717
Gene ID 80777
Gene Symbol CYB5B
Protein Name cytochrome b5 type B (outer mitochondrial membrane
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_030579.2
Length of RefSeq (bp) 4286
Chromosome 16q22.1
Reference DDBJ accession
UniGene Hs.461131
5'-terminal sequence TTGAAGGCTGAGCGCGGGCTCTCAAGGAAAGTAGTCGCGGAATCTCAGTTAGCGGTGGAG
2011.08.28