Prev. |  KEGG KO K07050 > 

RIKEN DNA Bank Human Resource - AARSD1

Gene ID NCBI Gene 80755 |  KEGG hsa:80755
Gene Symbol AARSD1
Protein Name alanyl-tRNA synthetase domain containing 1
Synonyms -
Ortholog resource in our bank

  AARSD1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080927 IRAL002F07 pOTB7 BC004172 NM_025267
HGY083979 IRAL009P19 pOTB7 BC019324 NM_025267 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR337780 RBb44H12 pGCAP1 NM_025267.2  
AAATGTGGACACGCCTGCAGGTATGGCGTTCTGGTGTCAGCGTGACAGTTATGCCCGAGA
HKR366050 RBd15C02 pGCAP10 NM_025267.2  
GACACGCCTGCAGGTATGGCGTTCTGGTGTCAGCGTGACAGTTATGCCCGAGAGTTCACC
HKR383306 RBd58E10 pGCAP10 NM_025267.2  
GAGGTATGGCGTTCTGGTGTCAGCGTGACAGTTATGCCCGAGAGTTCACCACCACCGTGG
HKR442039 RBdS105B15 pGCAP10 NM_025267.2  
GAGGATCTAAAGATAGCGGCCCCTGCCTGGAACTCTAAATGCCACCCTGGAGCGGGAGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl