Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - AARSD1

Gene ID (NCBI) 80755
Gene Symbol AARSD1
Protein Name alanyl-tRNA synthetase domain containing 1
Synonyms -
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY080927 IRAL002F07 pOTB7 BC004172 NM_025267
HGY083979 IRAL009P19 pOTB7 BC019324 NM_025267 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR366050 RBd15C02 pGCAP10 NM_025267.2
GACACGCCTGCAGGTATGGCGTTCTGGTGTCAGCGTGACAGTTATGCCCGAGAGTTCACC
HKR337780 RBb44H12 pGCAP1 NM_025267.2
AAATGTGGACACGCCTGCAGGTATGGCGTTCTGGTGTCAGCGTGACAGTTATGCCCGAGA
HKR383306 RBd58E10 pGCAP10 NM_025267.2
GAGGTATGGCGTTCTGGTGTCAGCGTGACAGTTATGCCCGAGAGTTCACCACCACCGTGG
HKR442039 RBdS105B15 pGCAP10 NM_025267.2
GAGGATCTAAAGATAGCGGCCCCTGCCTGGAACTCTAAATGCCACCCTGGAGCGGGAGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.10

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl