Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS105B15

Clone ID RBdS105B15
HP ID HP06202
Gene ID 80755
Gene Symbol AARSD1
Protein Name alanyl-tRNA synthetase domain containing 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_025267.2
Length of RefSeq (bp) 1835
Chromosome 17q21.31
Reference DDBJ accession
UniGene Hs.317403
5'-terminal sequence GAGGATCTAAAGATAGCGGCCCCTGCCTGGAACTCTAAATGCCACCCTGGAGCGGGAGCC
2011.08.28