Prev. |  KEGG KO K12602 > 

RIKEN DNA Bank Human Resource - WDR61

Gene ID NCBI Gene 80349 |  KEGG hsa:80349
Gene Symbol WDR61
Protein Name WD repeat domain 61
Synonyms REC14|SKI8
Ortholog resource in our bank

  WDR61

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY091153 IRAL027O17 pOTB7 BC010080 NM_025234 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR051609 ARe29A09 pKA1U5 NM_025234.1  
ATCCTGGCCCTTCGATAGCTCATCTTTGCGCGTCGCAGTCGCGCGGAGCCCGGCTTCCGA
HKR338854 RBb47C06 pGCAP1 NM_025234.1  
GGCAGTCGCGCGGAGCCCGGCCTTCCGACGTGCAGCCTGGCAGTTGCAGNTGAGCTGTC
HKR444327 RBdS110N15 pGCAP10 NM_025234.1  
GGGCTTCCGACGTGCAGCCTGGCAGTGCAGTGAGCTGTCTGGCCTTTTGTCCTTGATCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl