Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS110N15

Clone ID RBdS110N15
HP ID HP03200
Gene ID 80349
Gene Symbol WDR61
Protein Name WD repeat domain 61
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_025234.1
Length of RefSeq (bp) 1205
Chromosome 15q25.1
Reference DDBJ accession
UniGene Hs.513055
5'-terminal sequence GGGCTTCCGACGTGCAGCCTGGCAGTGCAGTGAGCTGTCTGGCCTTTTGTCCTTGATCCT
2011.08.28