Prev. | 

RIKEN DNA Bank Human Resource - WDCP

Gene ID NCBI Gene 80304 |  KEGG hsa:80304
Gene Symbol WDCP
Protein Name WD repeat and coiled coil containing
Synonyms C2orf44|MMAP|PP384
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX031606 IRAK079A06 pCMV-SPORT6 BC035698 NM_025203 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR420436 RBdS051B12 pGCAP10 NM_025203.2  
GACACAGAGAGATTGGTGTTTTTGTGAGGCAGTGAGACCTAAGGTAACCTTTATCAAAAG
HKR444352 RBdS110O16 pGCAP10 NM_025203.2  
GCCGGTGGCTGCCCAGAACTTCTTATGTGCGGCGGCGTGATGTTGGGCGGCCACAGAGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl