Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS051B12

Clone ID RBdS051B12
HP ID HP08971
Gene ID 80304
Gene Symbol C2orf44
Protein Name chromosome 2 open reading frame 44
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_025203.2
Length of RefSeq (bp) 3897
Chromosome 2p23.3
Reference DDBJ accession
UniGene Hs.24624
5'-terminal sequence GACACAGAGAGATTGGTGTTTTTGTGAGGCAGTGAGACCTAAGGTAACCTTTATCAAAAG
2011.08.28