Prev. | 

RIKEN DNA Bank Human Resource - ARMC9

Gene ID NCBI Gene 80210 |  KEGG hsa:80210
Gene Symbol ARMC9
Protein Name armadillo repeat containing 9
Synonyms ARM|JBTS30|KU-MEL-1|NS21
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB03749 SEREX clone NGO-St-101 (ID 575, 576) #1 SEREX clone NGO-St-101 (ID 575, 576) #1
RDB06715 pEThs_FLJ12584 Prokaryotic expression vector of human FLJ12584

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY085684 IRAL014D12 pOTB7 BC004514 NM_025139 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE096024 M01C040A24 pDONR221 MGC09-F12 BC065271 ENST00000349938  
HGE096072 M01C040C24 pDONR221 MGC09-F12 BC065271 ENST00000349938  
HGE096120 M01C040E24 pDONR221 MGC09-F12 BC065271 ENST00000349938  
HGE096168 M01C040G24 pDONR221 MGC09-F12 BC065271 ENST00000349938  
HGE096216 M01C040I24 pDONR221 MGC09-F12 BC065271 ENST00000349938  
HGE096264 M01C040K24 pDONR221 MGC09-F12 BC065271 ENST00000349938  
HGE096312 M01C040M24 pDONR221 MGC09-F12 BC065271 ENST00000349938  
HGE096360 M01C040O24 pDONR221 MGC09-F12 BC065271 ENST00000349938  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2022Apr03.csv

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE050480 W01A126D08 pENTR-TOPO IRAL020H24 BC017229  
HGE050482 W01A126D10 pENTR-TOPO IRAL020H24 BC017229  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2022Apr03.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR020179 ARa50H11 pKA1U5 NM_025139.3  
GGTCCTGGTGCTGGGAGGAGCAGCGGTGCGTTTGGAGGGCCGAGGCTCTGCGGACCTCTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl