Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ARMC9

Gene ID (NCBI) 80210
Gene Symbol ARMC9
Protein Name armadillo repeat containing 9
Synonyms ARM|KU-MEL-1
Databases KEGG link 01 |  NCBI Gene link 01


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB03749 SEREX clone NGO-St-101 (ID 575, 576) #1 SEREX clone NGO-St-101 (ID 575, 576) #1
RDB06715 pEThs_FLJ12584 Prokaryotic expression vector of human FLJ12584

RDB_hum_160722.csv


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX056315 IRAK140N03 pCMV-SPORT6 BC065271 NM_025139 Full/var
HGY085684 IRAL014D12 pOTB7 BC004514 NM_025139 Partial/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE096024 M01C040A24 pDONR221 MGC09-F12 BC065271 ENST00000349938
HGE096072 M01C040C24 pDONR221 MGC09-F12 BC065271 ENST00000349938
HGE096120 M01C040E24 pDONR221 MGC09-F12 BC065271 ENST00000349938
HGE096168 M01C040G24 pDONR221 MGC09-F12 BC065271 ENST00000349938
HGE096216 M01C040I24 pDONR221 MGC09-F12 BC065271 ENST00000349938
HGE096264 M01C040K24 pDONR221 MGC09-F12 BC065271 ENST00000349938
HGE096312 M01C040M24 pDONR221 MGC09-F12 BC065271 ENST00000349938
HGE096360 M01C040O24 pDONR221 MGC09-F12 BC065271 ENST00000349938

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR020179 ARa50H11 pKA1U5 NM_025139.3
GGTCCTGGTGCTGGGAGGAGCAGCGGTGCGTTTGGAGGGCCGAGGCTCTGCGGACCTCTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.11

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl