Prev. |  KEGG KO K09680 > 

RIKEN DNA Bank Human Resource - PANK2

Gene ID NCBI Gene 80025 |  KEGG hsa:80025
Gene Symbol PANK2
Protein Name pantothenate kinase 2
Synonyms C20orf48|HARP|HSS|NBIA1|PKAN
Ortholog resources KEGG ortholog (KEGG orthology K09680) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX056039 IRAK140B15 pCMV-SPORT6 BC065019 NM_153640 Full
HGY089353 IRAL023G09 pOTB7 BC009421 NM_153640 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE014168 W01A035G24 pENTR-TOPO flj0029m23 AK021791 NM_153640  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR180436 ARi51B12 pGCAP10 NM_024960.4  
GGCTCTGGCTGGACTGCCGCGGAGGAGGCGAGAAGGAATCCGACGCTGGGGGGCTTGCTC
HKR393726 RBd84F06 pGCAP10 NM_024960.4  
GGGCCGGCCGAGGGCGCGCCTCTGCTCTGGCTGGACTGCCGCGGAGGAGGCGAGAAGGAA
HKR393729 RBd84F09 pGCAP10 NM_024960.4  
GAGGCGCCTGCGCAGAGCCGCGCGTTGGCCTCCTGTTCCGCTTAAAGGGGCGGTGCAGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl