Prev. |  KEGG KO K14398 > 

RIKEN DNA Bank Human Resource - CPSF7

Gene ID NCBI Gene 79869 |  KEGG hsa:79869
Gene Symbol CPSF7
Protein Name cleavage and polyadenylation specific factor 7
Synonyms CFIm59
Ortholog resources KEGG ortholog (KEGG orthology K14398) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX009051 IRAK022K11 pCMV-SPORT6 BC018135 NM_024811

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR208043 ARiS020B19 pGCAP10 NM_024811.3  
GGGGGCGGAGAGCGGTTCGCGCGCTTCGGGCCTAGTCCGGACTCGCCGCCGCCGCCGCCA
HKR380451 RBd51C03 pGCAP10 NM_024811.3  
GGGAGAGCGGTTCGCGCGCTTCGGGCCTAGTCCGGACTCGCCGCCGCCGCCGCCATATTC
HKR420745 RBdS051O09 pGCAP10 NM_024811.3  
TTGACTCNCCGCCGCCGCCGCCATATTCCCGTGGCATCTTCCTTACTTTGTCCATCCTCC
HKR444081 RBdS110D09 pGCAP10 NM_024811.3  
GACTCTCGCCGCCGCCGCCGCCATATTCCCGTGGCATCTTCCTTACTTTGTCCATCCTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl