Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS110D09

Clone ID RBdS110D09
HP ID HP07445
Gene ID 79869
Gene Symbol CPSF7
Protein Name cleavage and polyadenylation specific factor 7, 59kDa
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_024811.3
Length of RefSeq (bp) 3764
Chromosome 11q12.2
Reference DDBJ accession
UniGene Hs.444552
5'-terminal sequence GACTCTCGCCGCCGCCGCCGCCATATTCCCGTGGCATCTTCCTTACTTTGTCCATCCTCC
2011.08.28