Prev. |  KEGG KO K13134 > 

RIKEN DNA Bank Human Resource - GEMIN6

Gene ID NCBI Gene 79833 |  KEGG hsa:79833
Gene Symbol GEMIN6
Protein Name gem nuclear organelle associated protein 6
Synonyms -
Ortholog resources KEGG ortholog (KEGG orthology K13134) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX008577 IRAK021H09 pCMV-SPORT6 BC018195 NM_024775 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE031701 W01A079E05 pENTR-TOPO IRAK021H09 BC018195 NM_024775  
HGE031705 W01A079E09 pENTR-TOPO IRAK021H09 BC018195 NM_024775  
HGE031707 W01A079E11 pENTR-TOPO IRAK021H09 BC018195 NM_024775  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR326122 RBb15F02 pKA1U5 NM_024775.9  
GCCTTCCTCAAAGCATGGTTGCTGAGTACCCAGCAGCTTGCGAGGAGTTTTTTAACTGAT
HKR373202 RBd33A02 pGCAP10 NM_024775.9  
GATGCTGGTCTCAGGCGGTCTCCGCTCAACGATCCTTCCTCAAAGCATGGTTGCTGAGTA
HKR430127 RBdS075F07 pGCAP10 NM_024775.9  
TGGCTCAACGATCCTTCCTCAAAGCATGGTTGCTGAGTACCCAGAGTTGCGAGGAGTTTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl