Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS075F07

Clone ID RBdS075F07
HP ID HP04639
Gene ID 79833
Gene Symbol GEMIN6
Protein Name Gem (nuclear organelle) associated protein 6
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_024775.9
Length of RefSeq (bp) 705
Chromosome 2p22.1
Reference DDBJ accession
UniGene Hs.143818
5'-terminal sequence TGGCTCAACGATCCTTCCTCAAAGCATGGTTGCTGAGTACCCAGAGTTGCGAGGAGTTTT
2011.08.28