Prev. | 

RIKEN DNA Bank Human Resource - AAGAB

Gene ID NCBI Gene 79719 |  KEGG hsa:79719
Gene Symbol AAGAB
Protein Name alpha and gamma adaptin binding protein
Synonyms KPPP1|PPKP1|PPKP1A|p34
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001708 IRAK004E12 pCMV-SPORT6 BC001975 NM_024666
HGX031930 IRAK079N18 pCMV-SPORT6 BC035852 NM_024666 Full/var
HGX047978 IRAK119P18 pCMV-SPORT6 BC058886 NM_024666 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR409003 RBdS022I11 pGCAP10 NM_024666.3  
GGCCTGACGGAACCGGCTCGCGAGCGCAGCTATGGCTGCTGGCGTACCCTGTGCGTTAGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl