Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS022I11

Clone ID RBdS022I11
HP ID HP08930
Gene ID 79719
Gene Symbol FLJ11506
Protein Name alpha- and gamma-adaptin-binding protein p34
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_024666.3
Length of RefSeq (bp) 2864
Chromosome 15q22.33-q23
Reference DDBJ accession
UniGene Hs.254642
5'-terminal sequence GGCCTGACGGAACCGGCTCGCGAGCGCAGCTATGGCTGCTGGCGTACCCTGTGCGTTAGT
2011.08.28