Prev. |  KEGG KO K18619 > 

RIKEN DNA Bank Human Resource - CORO7

Gene ID NCBI Gene 79585 |  KEGG hsa:79585
Gene Symbol CORO7
Protein Name coronin 7
Synonyms 0610011B16Rik|CRN7|POD1
Ortholog resource in our bank

  CORO7

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR182147 ARi55G03 pGCAP10 NM_024535.3 done
CGGCCGGCCGATGGAGTCGCGGTTGCTCAGCGTGCACCTGAGACCCGACGCCCGGGGTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.04.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl