Prev. |  Human A to Z list >   >   > 

ARi55G03 - NRCD Human cDNA Clone

Catalog Number HKR182147
Clone Name ARi55G03
Clone info. Plasmid clone of human CORO7 cDNA with SV40 promoter
Vector Click for information pGCAP10
5'-terminal sequence(1) CGGCCGGCCGATGGAGTCGCGGTTGCTCAGCGTGCACCTGAGACCCGACGCCCGGGGTCC
Sequence, submitted(2) n.a.
Note match to NM_024535.5 (1-3470) CDS:full/var(c.578G>A)
 
Sequence, refered NM_024535.3 (NCBI RefSeq mRNA)
Gene Symbol and ID(3)  (NCBI Gene 79585)  other clone of in our bank
Protein Name
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR182147 ARi55G03 DNA solution

Sequence information

Full length sequence and restriction map are not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

Seq File
(by primer A)
Seq File
(by primer B)
Seq File
(by primer C)
Seq File
(contig)
PDF File
ARi55G03a.seq   ARi55G03c.seq ARi55G03z.seq ARi55G03.pdf

References and tips

Featured content

Reference


2021.05.27

NRCDhumcloneList_AR_210404.csv - DataSheet_NRCD_html_200831.pl