Prev. | 

RIKEN DNA Bank Human Resource - EFHD2

Gene ID NCBI Gene 79180 |  KEGG hsa:79180
Gene Symbol EFHD2
Protein Name EF-hand domain family member D2
Synonyms SWS1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX006119 IRAK015E23 pCMV-SPORT6 BC014923 NM_024329 Full
HGY067090 IRAK167M02 pBluescriptR BC068473 NM_024329 Full
HGY088855 IRAL022C07 pOTB7 BC007233 NM_024329 Full
HGY093286 IRAL033D14 pOTB7 BC023611 NM_024329

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE092027 M01C030B03 pDONR221 MGC04-G02 BC014923 NM_024329  
HGE092075 M01C030D03 pDONR221 MGC04-G02 BC014923 NM_024329  
HGE092123 M01C030F03 pDONR221 MGC04-G02 BC014923 NM_024329  
HGE092171 M01C030H03 pDONR221 MGC04-G02 BC014923 NM_024329  
HGE092219 M01C030J03 pDONR221 MGC04-G02 BC014923 NM_024329  
HGE092267 M01C030L03 pDONR221 MGC04-G02 BC014923 NM_024329  
HGE092315 M01C030N03 pDONR221 MGC04-G02 BC014923 NM_024329  
HGE092363 M01C030P03 pDONR221 MGC04-G02 BC014923 NM_024329  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR049274 ARe23D02 pKA1U5 NM_024329.4  
GGGCGCTGCGCTGAGAGCAGGGGCCCGGCCAACCCTAGTGCCGCGCGGGCCACCATGGTC
HKR070932 ARe77F12 pKA1U5 NM_024329.4  
GGCGGCCGGCGGCGCTGCGCTGAGAGCAGGGNCCCTTNNCAAGGCGAGTGCCGCGCGGGC
HKR367610 RBd19A10 pGCAP10 NM_024329.4  
GGGAGTGTTGTAGAGCCTCGAGCCTGCGAGGAGCGCGCCGCCCGCCAGCTCCCTGCGTCC
HKR381729 RBd54F09 pGCAP10 NM_024329.4  
GGAGTGTCAGGAAGAGGAAGAGCGCGGCCGGCGGCGCTGCGCTNNNAGCAGGGGCCCGGC
HKR420766 RBdS051P06 pGCAP10 NM_024329.4  
GGAGCGCGGCCGGCGGCGCTGCGCTGAGAGCAGGGGCCCGGCCAAGGCGAGTGCCGCGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl