Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS051P06

Clone ID RBdS051P06
HP ID HP03259
Gene ID 79180
Gene Symbol EFHD2
Protein Name EF-hand domain family, member D2
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_024329.4
Length of RefSeq (bp) 2387
Chromosome 1p36.21
Reference DDBJ accession
UniGene Hs.465374
5'-terminal sequence GGAGCGCGGCCGGCGGCGCTGCGCTGAGAGCAGGGGCCCGGCCAAGGCGAGTGCCGCGCG
2011.08.28