Prev. | 

RIKEN DNA Bank Human Resource - LBHD1

Gene ID NCBI Gene 79081 |  KEGG hsa:79081
Gene Symbol LBHD1
Protein Name LBH domain containing 1
Synonyms C11orf48
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081637 IRAL004B13 pOTB7 BC001434 NM_024099

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR338570 RBb46H02 pGCAP1 NM_024099.3  
TGGGAGTGGAATCGCGACTATGGGAGCTCCGGGGGGAAAGATCAACCGGCCCCGAACGGA
HKR364835 RBd12B11 pGCAP10 NM_024099.3  
GAAGCGTTCCTGAGCCCTTTTATCTCGCACGAGATGGGATCAGTGAGGGGCCGGGGCTGC
HKR367605 RBd19A05 pGCAP10 NM_024099.3  
GGACTATGGGAGCTCCGGGGGGAAAGATCAACCGGCCCCGAACGGTGACTGTGTGGGGGC
HKR416298 RBdS040M10 pGCAP10 NM_024099.3  
GAGTGGAATCGCGACTATGGGAGCTCCGGGGGGAAAGATCAACCGGCCCCGAACGGAGCT
HKR442275 RBdS105L11 pGCAP10 NM_024099.3  
TGGTGGAATCGCGACTATGGGAGCTCCGGGGGGAAAGATCAACCGGCCCCGAACGGAGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl