Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS105L11

Clone ID RBdS105L11
HP ID HP10558
Gene ID 79081
Gene Symbol C11orf48
Protein Name chromosome 11 open reading frame 48
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_024099.3
Length of RefSeq (bp) 1357
Chromosome 11q12.3
Reference DDBJ accession
UniGene Hs.9061
5'-terminal sequence TGGTGGAATCGCGACTATGGGAGCTCCGGGGGGAAAGATCAACCGGCCCCGAACGGAGCT
2011.08.28