Prev. |  KEGG KO K12180 > 

RIKEN DNA Bank Human Resource - COPS7B

Gene ID NCBI Gene 64708 |  KEGG hsa:64708
Gene Symbol COPS7B
Protein Name COP9 signalosome subunit 7B
Synonyms CSN7B|SGN7b
Ortholog resource in our bank

  COPS7B

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR190005 ARi75A05 pGCAP10 NM_022730.1  
GACGCCGGGGTGATCATGGACGCTTGACAACCTGCGGGCAGGCGCCGGGAGGCCGAGCCA
HKR397373 RBd93H05 pGCAP10 NM_022730.1  
GGCGCAAATTCACAAACCCGCCCGCTGAGTTGGTCGTTTCGGAATCCCGAGACTTGAAAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl