Prev. |  Human A to Z list >  C >  COPS7B > 

ARi75A05 - NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog Number HKR190005
Clone Name ARi75A05
Clone info. Plasmid clone of human COPS7B cDNA with SV40 promoter
Vector Click for information pGCAP10
5'-terminal sequence(1) GACGCCGGGGTGATCATGGACGCTTGACAACCTGCGGGCAGGCGCCGGGAGGCCGAGCCA
Sequence, submitted(2) n.a.
 
Sequence, refered NM_022730.1 (NCBI RefSeq mRNA)
Gene Symbol and ID(3) COPS7B (NCBI Gene 64708)  other clone of COPS7B in our bank
Synonyms CSN7B|SGN7b
Protein Name COP9 signalosome subunit 7B
KEGG hsa:64708
Links

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR190005 ARi75A05 DNA solution

Sequence information

Full length sequence and restriction map are not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference


2018.11.20

NRCDhumcloneList_AR_160109.csv - GNP_filter3_NRCD_html_180123.pl