Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - AASDHPPT

Gene ID (NCBI) 60496
Gene Symbol AASDHPPT
Protein Name aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase
Synonyms AASD-PPT|LYS2|LYS5
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K06133)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX009090 IRAK022M02 pCMV-SPORT6 BC015470 NM_015423 Full
HGY093063 IRAL032K23 pDNR-LIB BC016728 NM_015423 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR169708 ARi24E12 pGCAP10 NM_015423.2  
GGCGTCCGCGCCATCAGGCCCGAGATAGCGGCGAGGTCCGCTTTCNGTGTATGGTTTTCC
HKR379700 RBd49E04 pGCAP10 NM_015423.2  
GGTTTGCGTCCGCGCCATCAGGCCCGAGATAGCGGCGAGGTCCGCTTTCAGTGTATGGTT
HKR444080 RBdS110D08 pGCAP10 NM_015423.2  
GGCGCCATCAGGCCCGAGATAGCGGCGAGGTCCGCTTTCAGTGTATGGTTTTCCCTGCCA
HKR475140 RBdS187O04 pGCAP10 NM_015423.2  
GATGGTTTTCCCTGCCAAACGGTTCTGCTTGGTGCCATCCATGGAGGGCGTGCGCTGGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.26

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl