Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS187O04

Clone ID RBdS187O04
HP ID HP07111
Gene ID 60496
Gene Symbol AASDHPPT
Protein Name aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_015423.2
Length of RefSeq (bp) 2880
Chromosome 11q22
Reference DDBJ accession
UniGene Hs.524009
5'-terminal sequence GATGGTTTTCCCTGCCAAACGGTTCTGCTTGGTGCCATCCATGGAGGGCGTGCGCTGGGC
2011.08.28