Prev. |  KEGG KO K12472 > 

RIKEN DNA Bank Human Resource - EPS15L1

Gene ID NCBI Gene 58513 |  KEGG hsa:58513
Gene Symbol EPS15L1
Protein Name epidermal growth factor receptor pathway substrate 15 like 1
Synonyms EPS15R
Featured content Endocytosis (human)
Ortholog resource in our bank

  EPS15L1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX025798 IRAK064I06 pCMV-SPORT6 BC037558 NM_021235 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR188003 ARi70A03 pGCAP10 NM_021235.1  
GCCAGGCGCTCGGAGCCCGAGTCCGCGGGAAGATGGCGGCGCCGCTCATCCCCCTCTCCC
HKR203380 ARiS008H12 pGCAP10 NM_021235.1  
GGCTCGGAGCCCGANNCCGCGGGAAGATGGCGGCGCCGCTCATCCCCCTCTCCCAGCAGA
HKR409011 RBdS022I19 pGCAP10 NM_021235.1  
GGCCCGAGTCCGCGGGAAGATGGCGGCGCCGCTCATCCCCCTCTCCCAGCAGATTCCCAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl