Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS022I19

Clone ID RBdS022I19
HP ID HP07279
Gene ID 58513
Gene Symbol EPS15L1
Protein Name epidermal growth factor receptor pathway substrate 15-like 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_021235.1
Length of RefSeq (bp) 2774
Chromosome 19p13.11
Reference DDBJ accession
UniGene Hs.654639
5'-terminal sequence GGCCCGAGTCCGCGGGAAGATGGCGGCGCCGCTCATCCCCCTCTCCCAGCAGATTCCCAC
2011.08.28