Prev. | 

RIKEN DNA Bank Human Resource - AGTRAP

Gene ID NCBI Gene 57085 |  KEGG hsa:57085
Gene Symbol AGTRAP
Protein Name angiotensin II receptor associated protein
Synonyms ATRAP
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY095695 IRAL039D23 pOTB7 BC017328 NM_020350 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR398124 RBd95F04 pGCAP10 NM_020350.4  
GGGGGTTGGAGTGGCCGCAACGGGCGGGGCGGGGCCGGGCAAGTTTGTTCCCCGAGTTCG
HKR416225 RBdS040J09 pGCAP10 NM_020350.4  
GGTTCCCCGAGTTCGGAGCCTAGGAGCCCCCCGCGGCTGCGGCGCAGGTGCCCTCGGCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.17

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl