Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS040J09

Clone ID RBdS040J09
HP ID HP10663
Gene ID 57085
Gene Symbol AGTRAP
Protein Name angiotensin II receptor-associated protein
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_020350.4
Length of RefSeq (bp) 1200
Chromosome 1p36.22
Reference DDBJ accession
UniGene Hs.464438
5'-terminal sequence GGTTCCCCGAGTTCGGAGCCTAGGAGCCCCCCGCGGCTGCGGCGCAGGTGCCCTCGGCCT
2011.08.28