Prev. |  KEGG KO K14859 > 

RIKEN DNA Bank Human Resource - PPAN

Gene ID NCBI Gene 56342 |  KEGG hsa:56342
Gene Symbol PPAN
Protein Name peter pan homolog
Synonyms BXDC3|SSF|SSF-1|SSF1|SSF2
Ortholog resources KEGG ortholog (KEGG orthology K14859) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082001 IRAL005A01 pOTB7 BC000535 NM_020230 Partial/var
HGY090288 IRAL025L24 pOTB7 BC009833 NM_020230 Full
HGY097380 IRAL043H12 pOTB7 BC033202 NM_020230 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR162405 ARi06A05 pGCAP10 NM_020230.4  
GCTCGGCCTAGTCTTCGTAGCTGCAGTAATGGCTCCCGCTGTAAAACTGTGGGAGGACTT
HKR375776 RBd39H08 pGCAP10 NM_020230.4  
GGCGCAGCGCCGGAAGCGGCGGACGCAGGAGGCCTCGTGGAGGACACAGCAGCATGGGAC
HKR408994 RBdS022I02 pGCAP10 NM_020230.4  
GAGCTGCGCAGCGCCGGAAGCGGCGGACGCAGGAGGCCTCGTGGAGGACACAGCAGCATG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.17

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl