Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS022I02

Clone ID RBdS022I02
HP ID HP06875
Gene ID 56342
Gene Symbol PPAN
Protein Name peter pan homolog (Drosophila)
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_020230.4
Length of RefSeq (bp) 1679
Chromosome 19p13
Reference DDBJ accession
UniGene
5'-terminal sequence GAGCTGCGCAGCGCCGGAAGCGGCGGACGCAGGAGGCCTCGTGGAGGACACAGCAGCATG
2011.08.28