Prev. |  KEGG KO K01895 > 

RIKEN DNA Bank Human Resource - ACSS2

Gene ID NCBI Gene 55902 |  KEGG hsa:55902
Gene Symbol ACSS2
Protein Name acyl-CoA synthetase short chain family member 2
Synonyms ACAS2|ACECS|ACS|ACSA|AceCS1|dJ1161H23.1
Ortholog resource in our bank

  ACSS2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX066661 IRAK166K21 pCMV-SPORT6 BC073846 NM_139274 Full
HGY091112 IRAL027M24 pOTB7 BC010141 NM_018677 Partial
HGY091871 IRAL029L07 pOTB7 BC012172 NM_018677 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR408936 RBdS022F16 pGCAP10 NM_001076552.1  
GAAAGGCGGCCGCGGTTCTAGGAACTTGACGTGATGGGGCTTCCTGAGGAGCGGGTCCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl